pet30b expression vectors (Millipore)
Millipore is a verified supplier 
90
Structured Review
Millipore
pet30b expression vectors
Pet30b Expression Vectors, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pet30b+expression+vector/pet28a/pmc11166852-160-4-7
Average 90 stars, based on 1 article reviews
Pet30b Expression Vectors, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pet30b+expression+vector/pet28a/pmc11166852-160-4-7
Average 90 stars, based on 1 article reviews
pet30b expression vectors - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Clone Assay:Article Title: Structural and Functional Investigation of the Ag(+)/Cu(+) Binding Domains of the Periplasmic Adaptor Protein SilB from Cupriavidus metallidurans CH34. Article Snippet: Silver ion resistance in bacteria mainly relies on efflux systems, and notably on tripartite efflux complexes involving a transporter from the resistance−nodulation−cell division (RND) superfamily, such as the SilCBA system from Cupriavidus metallidurans CH34.. The periplasmic adaptor protein SilB hosts two specific metal coordination sites, located in the N-terminal and C-terminal domains, respectively, that are believed to play a different role in the efflux mechanism and the trafficking of metal ions from the periplasm to the RND transporter.. On the basis of the known domain structure of periplasmic adaptor proteins, we designed different protein constructs derived from SilB domains with either one or two metal binding sites per protein chain. Article Title: Characterization of Putative Virulence Factors of Pseudomonas aeruginosa Strain RBS Isolated from a Saltern, Tunisia: Effect of Metal Ion Cofactors on the Structure and the Activity of LasB Article Snippet: The amplified PCR product was cloned in the pJET1.2/blunt vector (ThermoFisher Scientific) prior to sequencing. .. The lasB gene was then excised by digesting with Nde I and Xho I and cloned into the Expressing:Article Title: Structural and Functional Investigation of the Ag(+)/Cu(+) Binding Domains of the Periplasmic Adaptor Protein SilB from Cupriavidus metallidurans CH34. Article Snippet: Silver ion resistance in bacteria mainly relies on efflux systems, and notably on tripartite efflux complexes involving a transporter from the resistance−nodulation−cell division (RND) superfamily, such as the SilCBA system from Cupriavidus metallidurans CH34.. The periplasmic adaptor protein SilB hosts two specific metal coordination sites, located in the N-terminal and C-terminal domains, respectively, that are believed to play a different role in the efflux mechanism and the trafficking of metal ions from the periplasm to the RND transporter.. On the basis of the known domain structure of periplasmic adaptor proteins, we designed different protein constructs derived from SilB domains with either one or two metal binding sites per protein chain. Article Title: Method for detecting pancreatic cancer Article Snippet: .. The plasmid that matched the target sequence was treated with NdeI and KpnI restriction enzymes, the resultant was purified using a QIAquick Gel Extraction Kit, and the target gene sequence was inserted into a Article Title: Characterization of Putative Virulence Factors of Pseudomonas aeruginosa Strain RBS Isolated from a Saltern, Tunisia: Effect of Metal Ion Cofactors on the Structure and the Activity of LasB Article Snippet: The amplified PCR product was cloned in the pJET1.2/blunt vector (ThermoFisher Scientific) prior to sequencing. .. The lasB gene was then excised by digesting with Nde I and Xho I and cloned into the Article Title: Abnormal Cannabidiol Modulates Vitamin A Metabolism by Acting as a Competitive Inhibitor of CRBP1 Article Snippet: .. The cDNA of human CRBP2 was purchased from Origene Technologies and amplified by polymerase chain reaction (PCR) using the following primers: forward –GCAGATCATATGACAAGGGACCAGAATGGAACC and reverse –CGTCTACTCGAGTCCCGGGGATCCACGCGGAACCAGTTTCTTTTTGAACACTTGACGG to subclone into Article Title: Method for detecting cancer using CAPRIN-1 as a marker Article Snippet: .. Then the gene sequence of interest was inserted into a Plasmid Preparation:Article Title: Structural and Functional Investigation of the Ag(+)/Cu(+) Binding Domains of the Periplasmic Adaptor Protein SilB from Cupriavidus metallidurans CH34. Article Snippet: Silver ion resistance in bacteria mainly relies on efflux systems, and notably on tripartite efflux complexes involving a transporter from the resistance−nodulation−cell division (RND) superfamily, such as the SilCBA system from Cupriavidus metallidurans CH34.. The periplasmic adaptor protein SilB hosts two specific metal coordination sites, located in the N-terminal and C-terminal domains, respectively, that are believed to play a different role in the efflux mechanism and the trafficking of metal ions from the periplasm to the RND transporter.. On the basis of the known domain structure of periplasmic adaptor proteins, we designed different protein constructs derived from SilB domains with either one or two metal binding sites per protein chain. Article Title: Method for detecting pancreatic cancer Article Snippet: .. The plasmid that matched the target sequence was treated with NdeI and KpnI restriction enzymes, the resultant was purified using a QIAquick Gel Extraction Kit, and the target gene sequence was inserted into a Article Title: Characterization of Putative Virulence Factors of Pseudomonas aeruginosa Strain RBS Isolated from a Saltern, Tunisia: Effect of Metal Ion Cofactors on the Structure and the Activity of LasB Article Snippet: The amplified PCR product was cloned in the pJET1.2/blunt vector (ThermoFisher Scientific) prior to sequencing. .. The lasB gene was then excised by digesting with Nde I and Xho I and cloned into the Article Title: Abnormal Cannabidiol Modulates Vitamin A Metabolism by Acting as a Competitive Inhibitor of CRBP1 Article Snippet: .. The cDNA of human CRBP2 was purchased from Origene Technologies and amplified by polymerase chain reaction (PCR) using the following primers: forward –GCAGATCATATGACAAGGGACCAGAATGGAACC and reverse –CGTCTACTCGAGTCCCGGGGATCCACGCGGAACCAGTTTCTTTTTGAACACTTGACGG to subclone into Article Title: Method for detecting cancer using CAPRIN-1 as a marker Article Snippet: .. Then the gene sequence of interest was inserted into a other:Article Title: Three-Dimensional Structure of N-Terminal Domain of DnaB Helicase and Helicase-Primase Interactions in Helicobacter pylori Article Snippet: The PCR product was subsequently digested with SalI restriction enzyme and cloned in Article Title: Functional characterization and transcriptional analysis of galE gene encoding a UDP-galactose 4-epimerase in Xanthomonas campestris pv. campestris. Article Snippet: After sequence confirmation, the fragment as excised from pTgalE and cloned into the Article Title: Commonality of Virulence-Promoting Function in Rhodococcus equi Virulence Associated Proteins (Vaps) Article Snippet: All genes expressing the Vaps’ core region (see supplementary data for sequences) were cloned into pET30b or Sequencing:Article Title: Method for detecting pancreatic cancer Article Snippet: .. The plasmid that matched the target sequence was treated with NdeI and KpnI restriction enzymes, the resultant was purified using a QIAquick Gel Extraction Kit, and the target gene sequence was inserted into a Article Title: Abnormal Cannabidiol Modulates Vitamin A Metabolism by Acting as a Competitive Inhibitor of CRBP1 Article Snippet: .. The cDNA of human CRBP2 was purchased from Origene Technologies and amplified by polymerase chain reaction (PCR) using the following primers: forward –GCAGATCATATGACAAGGGACCAGAATGGAACC and reverse –CGTCTACTCGAGTCCCGGGGATCCACGCGGAACCAGTTTCTTTTTGAACACTTGACGG to subclone into Article Title: Method for detecting cancer using CAPRIN-1 as a marker Article Snippet: .. Then the gene sequence of interest was inserted into a Purification:Article Title: Method for detecting pancreatic cancer Article Snippet: .. The plasmid that matched the target sequence was treated with NdeI and KpnI restriction enzymes, the resultant was purified using a QIAquick Gel Extraction Kit, and the target gene sequence was inserted into a Article Title: Abnormal Cannabidiol Modulates Vitamin A Metabolism by Acting as a Competitive Inhibitor of CRBP1 Article Snippet: .. The cDNA of human CRBP2 was purchased from Origene Technologies and amplified by polymerase chain reaction (PCR) using the following primers: forward –GCAGATCATATGACAAGGGACCAGAATGGAACC and reverse –CGTCTACTCGAGTCCCGGGGATCCACGCGGAACCAGTTTCTTTTTGAACACTTGACGG to subclone into Gel Extraction:Article Title: Method for detecting pancreatic cancer Article Snippet: .. The plasmid that matched the target sequence was treated with NdeI and KpnI restriction enzymes, the resultant was purified using a QIAquick Gel Extraction Kit, and the target gene sequence was inserted into a Amplification:Article Title: Abnormal Cannabidiol Modulates Vitamin A Metabolism by Acting as a Competitive Inhibitor of CRBP1 Article Snippet: .. The cDNA of human CRBP2 was purchased from Origene Technologies and amplified by polymerase chain reaction (PCR) using the following primers: forward –GCAGATCATATGACAAGGGACCAGAATGGAACC and reverse –CGTCTACTCGAGTCCCGGGGATCCACGCGGAACCAGTTTCTTTTTGAACACTTGACGG to subclone into Polymerase Chain Reaction:Article Title: Abnormal Cannabidiol Modulates Vitamin A Metabolism by Acting as a Competitive Inhibitor of CRBP1 Article Snippet: .. The cDNA of human CRBP2 was purchased from Origene Technologies and amplified by polymerase chain reaction (PCR) using the following primers: forward –GCAGATCATATGACAAGGGACCAGAATGGAACC and reverse –CGTCTACTCGAGTCCCGGGGATCCACGCGGAACCAGTTTCTTTTTGAACACTTGACGG to subclone into Introduce:Article Title: Abnormal Cannabidiol Modulates Vitamin A Metabolism by Acting as a Competitive Inhibitor of CRBP1 Article Snippet: .. The cDNA of human CRBP2 was purchased from Origene Technologies and amplified by polymerase chain reaction (PCR) using the following primers: forward –GCAGATCATATGACAAGGGACCAGAATGGAACC and reverse –CGTCTACTCGAGTCCCGGGGATCCACGCGGAACCAGTTTCTTTTTGAACACTTGACGG to subclone into |